Stem-loop sequence bta-mir-940

AccessionMI0009909 (change log)
DescriptionBos taurus miR-940 stem-loop
Gene family MIPF0000540; mir-940
Literature search

2 open access papers mention bta-mir-940
(2 sentences)

Stem-loop
   g      gugggc       ca         -  ug g aac   gugug 
5'  uggggu      ugggccc  ggagugggg cc  g c   ccu     u
    ||||||      |||||||  ||||||||| ||  | |   |||      
3'  acccca      guccggg  ccucgcccc gg  c g   gga     u
   -      ------       cg         c  gu g -aa   aggag 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 1803355-1803447 [+]
intergenic
Database links

Mature sequence bta-miR-940

Accession MIMAT0009386
Sequence

60 - 

aaggcugggcccccgcuccgc

 - 80

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0005762
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).