Stem-loop sequence bta-mir-935

AccessionMI0009908 (change log)
DescriptionBos taurus miR-935 stem-loop
Gene family MIPF0000606; mir-935
Stem-loop
            gcg      a             ccc  c   caucc 
5' ggcgggggc   ggcggc guggcgggagcgg   cu ggc     u
   |||||||||   |||||| |||||||||||||   || |||      
3' ucgcccucg   ccgccg caucgccuucgcc   ga ccg     c
            ---      c             auu  c   ucugc 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 62402146-62402236 [+]
sense
ENSBTAT00000009879 ; bta-mir-935-201; 3'UTR (exon 4)
Database links

Mature sequence bta-miR-935

Accession MIMAT0009385
Sequence

56 - 

ccaguuaccgcuuccgcuaccgc

 - 78

Get sequence
Deep sequencing12 reads, 9 experiments
Evidence by similarity; MI0005757
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).