Stem-loop sequence bta-mir-885

AccessionMI0009904 (change log)
DescriptionBos taurus miR-885 stem-loop
Gene family MIPF0000532; mir-885
Literature search

3 open access papers mention bta-mir-885
(13 sentences)

Stem-loop
   --   c     c           a  -         cu 
5'   ccg gcucu uccauuacacu cc cugccucuu  c
     ||| ||||| ||||||||||| || |||||||||   
3'   ggc cgaga aggugaugugg gg gacggagag  c
   ug   a     u           -  c         ca 
Get sequence
Deep sequencing
697 reads, 15.3 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 55292168-55292241 [-]
sense
ENSBTAT00000001723 ; ATP2B2-201; intron 6
Database links

Mature sequence bta-miR-885

Accession MIMAT0009382
Sequence

11 - 

uccauuacacuacccugccucu

 - 32

Get sequence
Deep sequencing269 reads, 58 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).