Stem-loop sequence bta-mir-877

AccessionMI0009903 (change log)
DescriptionBos taurus miR-877 stem-loop
Gene family MIPF0000392; mir-877
Literature search

5 open access papers mention bta-mir-877
(7 sentences)

Stem-loop
   gcucgagaa  ua      au  c c          ggcuaagac      c  c 
5'          gg  gaggag  gg g aggggacacg         uggggg uc c
            ||  ||||||  || | ||||||||||         |||||| ||  
3'          cc  cuccuc  cc c ucuccugugu         accccc ag g
   gcaugugga  --      --  u u          ------aca      c  g 
Get sequence
Deep sequencing
1288 reads, 16.4 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 28284423-28284524 [-]
sense
ENSBTAT00000009098 ; ABCF1-201; exon 14
Clustered miRNAs
< 10kb from bta-mir-877
bta-mir-877chr23: 28284423-28284524 [-]
bta-mir-2378chr23: 28284050-28284127 [-]
Database links

Mature sequence bta-miR-877

Accession MIMAT0009381
Sequence

11 - 

guagaggagauggcgcaggg

 - 30

Get sequence
Deep sequencing1240 reads, 73 experiments
Evidence by similarity; MI0005561
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).