Stem-loop sequence bta-mir-876

AccessionMI0009902 (change log)
DescriptionBos taurus miR-876 stem-loop
Gene family MIPF0000430; mir-876
Stem-loop
   u    ug         u                aucuaa  u 
5'  gaag  cuguggauu cuuugugaaucaccau      gc a
    ||||  ||||||||| ||||||||||||||||      ||  
3'  cuuc  gauacuuaa gaaacauuugguggug      ug a
   a    gu         u                -----g  u 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 15250896-15250976 [+]
intergenic
Database links

Mature sequence bta-miR-876

Accession MIMAT0009380
Sequence

11 - 

uggauuucuuugugaaucacca

 - 32

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence by similarity; MI0005542
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).