Stem-loop sequence bta-mir-875

AccessionMI0009901 (change log)
DescriptionBos taurus miR-875 stem-loop
Gene family MIPF0000424; mir-875
Stem-loop
   --      gg  uau        u  a       uuau 
5'   uuagug  ac   accucagu uu ucaggug    u
     ||||||  ||   |||||||| || |||||||    u
3'   agucac  ug   uggaguca aa gguccac    a
   ca      uu  ugu        u  a       uaaa 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 67323808-67323884 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-875
bta-mir-875chr14: 67323808-67323884 [+]
bta-mir-599chr14: 67323940-67324034 [+]
Database links

Mature sequence bta-miR-875

Accession MIMAT0009379
Sequence

11 - 

uauaccucaguuuuaucaggug

 - 32

Get sequence
Evidence by similarity; MI0010430
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).