Stem-loop sequence bta-mir-874

AccessionMI0009900 (change log)
DescriptionBos taurus miR-874 stem-loop
Gene family MIPF0000401; mir-874
Literature search

6 open access papers mention bta-mir-874
(18 sentences)

Stem-loop
   --      cug   c   a  ca        a ag  a 
5'   uuagcc   cgg ccc cg  ccagggua g  ag c
     ||||||   ||| ||| ||  |||||||| |  || u
3'   ggucgg   gcc ggg gc  ggucccgu c  uc c
   cg      uca   a   a  cc        - cu  a 
Get sequence
Deep sequencing
2809 reads, 7.25 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 50886238-50886313 [-]
sense
ENSBTAT00000003625 ; KLHL3-201; intron 7
Database links

Mature sequence bta-miR-874

Accession MIMAT0009378
Sequence

45 - 

cugcccuggcccgagggaccga

 - 66

Get sequence
Deep sequencing2459 reads, 69 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).