Stem-loop sequence bta-mir-873

AccessionMI0009899 (change log)
DescriptionBos taurus miR-873 stem-loop
Gene family MIPF0000390; mir-873
Literature search

1 open access papers mention bta-mir-873
(1 sentences)

Stem-loop
   --   u ca   g a      ug g        a  ga 
5'   gug g  uuu c ggaacu  u agucuccu uu  a
     ||| |  ||| | ||||||  | |||||||| ||  c
3'   cac c  aag g ccuuga  a ucggagga aa  a
   aa   c ac   g c      gu g        c  gu 
Get sequence
Deep sequencing
72 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 15227232-15227308 [+]
intergenic
Database links

Mature sequence bta-miR-873

Accession MIMAT0009377
Sequence

11 - 

gcaggaacuugugagucuccu

 - 31

Get sequence
Deep sequencing62 reads, 29 experiments
Evidence by similarity; MI0005564
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).