Stem-loop sequence bta-mir-769

AccessionMI0009898 (change log)
DescriptionBos taurus miR-769 stem-loop
Gene family MIPF0000727; mir-769
Literature search

1 open access papers mention bta-mir-769
(2 sentences)

Stem-loop
   gacuuggugcugauucccggcgcu    c          c   u   g     u  ug 
5'                         cuga cugagaccuc ggg ucu agcug ga  u
                           |||| |||||||||| ||| ||| ||||| ||  u
3'                         gacu ggcucugggg cuc agg ucgac cu  g
   cgagucuugggucuccagggcugg    u          u   u   g     c  uc 
Get sequence
Deep sequencing
13740 reads, 101 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 54188012-54188130 [+]
intergenic
Database links

Mature sequence bta-miR-769

Accession MIMAT0009376
Sequence

31 - 

ugagaccuccggguucugagcu

 - 52

Get sequence
Deep sequencing13422 reads, 70 experiments
Evidence by similarity; MI0003834
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).