Stem-loop sequence bta-mir-767

AccessionMI0009897 (change log)
DescriptionBos taurus miR-767 stem-loop
Gene family MIPF0000552; mir-767
Literature search

1 open access papers mention bta-mir-767
(1 sentences)

Stem-loop
   ---uuu   uuaua            u c       uu  c      u    c 
5'       gua     gguuuuugcuca g accaugg  gu ugagca gcag a
         |||     |||||||||||| | |||||||  || |||||| |||| u
3'       cgu     ccaaggacgagu c ugguacc  ca acucgu uguu g
   gucauu   cacug            c u       -c  u      c    c 
Get sequence
Deep sequencing
759 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 35237578-35237682 [-]
sense
ENSBTAT00000008798 ; GABRA3-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-767
bta-mir-105bchrX: 35238515-35238594 [-]
bta-mir-767chrX: 35237578-35237682 [-]
bta-mir-105achrX: 35236061-35236141 [-]
Database links

Mature sequence bta-miR-767

Accession MIMAT0009375
Sequence

24 - 

ugcaccaugguugucugagcaug

 - 46

Get sequence
Deep sequencing746 reads, 63 experiments
Evidence by similarity; MI0003763
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).