Stem-loop sequence bta-mir-763

AccessionMI0009896 (change log)
DescriptionBos taurus miR-763 stem-loop
Gene family MIPF0000722; mir-763
Literature search

1 open access papers mention bta-mir-763
(1 sentences)

Stem-loop
         gga   -gc           ga         a ca         aac   u      
5' aaugau   ggu   aggcauuuccu  ggauuaaug c  gcugggagg   cag ggccc 
   ||||||   |||   |||||||||||  ||||||||| |  |||||||||   ||| |||| u
3' uugcug   ucg   ucuguaaagga  cuuaauuac g  cgacccucc   guc ucggu 
         gag   uuu           gc         c ac         ---   -      
Get sequence
Deep sequencing
41 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 48331034-48331153 [-]
sense
ENSBTAT00000061005 ; HMGA2-201; intron 3
Database links

Mature sequence bta-miR-763

Accession MIMAT0009374
Sequence

38 - 

ccagcugggaggaaccaguggc

 - 59

Get sequence
Evidence by similarity; MI0004516
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).