Stem-loop sequence bta-mir-761

AccessionMI0009895 (change log)
DescriptionBos taurus miR-761 stem-loop
Gene family MIPF0000709; mir-761
Stem-loop
   -uggcaaga                      g  a  g 
5'          ggaggagcagcagggugaaacu ac ca u
            |||||||||||||||||||||| || ||  
3'          ccuccucgucguuucacuuuga ug gu u
   acucuuaga                      g  -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 95392259-95392334 [+]
sense
ENSBTAT00000028220 ; NRD1-201; 3'UTR (exon 4)
Database links

Mature sequence bta-miR-761

Accession MIMAT0009373
Sequence

15 - 

gcagcagggugaaacugacaca

 - 36

Get sequence
Evidence by similarity; MI0010435
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).