Stem-loop sequence bta-mir-760

AccessionMI0009894 (change log)
DescriptionBos taurus miR-760 stem-loop
Gene family MIPF0000395; mir-760
Literature search

1 open access papers mention bta-mir-760
(1 sentences)

Stem-loop
   ggaggaugcugcagcg    gc  --g    c    u   ucca        c    acc 
5'                 uggg  gc   ucgc cccc cag    ccagagcc ggau   u
                   ||||  ||   |||| |||| |||    |||||||| ||||   u
3'                 accc  cg   agcg gggg guc    ggucucgg cuua   a
   -gccguuuuaccucaa    aa  uaa    a    u   --ug        -    aag 
Get sequence
Deep sequencing
1785 reads, 4.55 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 50024716-50024832 [-]
intergenic
Database links

Mature sequence bta-miR-760-5p

Accession MIMAT0009372
Previous IDsbta-miR-760
Sequence

31 - 

ccccucaguccaccagagcccg

 - 52

Get sequence
Deep sequencing23 reads, 20 experiments
Evidence by similarity; MI0004605
Predicted targets

Mature sequence bta-miR-760-3p

Accession MIMAT0022951
Sequence

68 - 

cggcucugggucugugggga

 - 87

Get sequence
Deep sequencing1759 reads, 66 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).