Stem-loop sequence bta-mir-759

AccessionMI0009893 (change log)
DescriptionBos taurus miR-759 stem-loop
Gene family MIPF0000706; mir-759
Stem-loop
   ggauuau             cc     u g   ac        a   u  cu 
5'        aauaaauuaaaug  uaaac g cag  ugcaaaca uuu ga  u
          |||||||||||||  ||||| | |||  |||||||| ||| ||   
3'        uuguuuaauuuac  auuug c guc  acguuugu aaa cu  a
   -------             aa     u g   --        -   u  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 11026563-11026658 [-]
intergenic
Database links

Mature sequence bta-miR-759

Accession MIMAT0009371
Sequence

30 - 

gcagacugcaaacaauuuugac

 - 51

Get sequence
Evidence by similarity; MI0004554
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).