Stem-loop sequence bta-mir-744

AccessionMI0009891 (change log)
DescriptionBos taurus miR-744 stem-loop
Gene family MIPF0000431; mir-744
Literature search

4 open access papers mention bta-mir-744
(5 sentences)

Stem-loop
    gu    cg    gc    c   -   u       --g  -ucacuga   u 
5' g  uggg  gggu  gggg uag ggc aacagca   gc        cgg u
   |  ||||  ||||  |||| ||| ||| |||||||   ||        |||  
3' c  gcuc  ucca  cucc auc ccg uugucgu   cg        gcc u
    ug    au    -a    a   a   -       aca  caccaaag   c 
Get sequence
Deep sequencing
4637 reads, 10.4 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 31492233-31492332 [+]
sense
ENSBTAT00000044085 ; MAP2K4-201; intron 4
Database links

Mature sequence bta-miR-744

Accession MIMAT0009369
Sequence

13 - 

ugcggggcuagggcuaacagca

 - 34

Get sequence
Deep sequencing4495 reads, 67 experiments
Evidence by similarity; MI0004124
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).