Stem-loop sequence bta-mir-708

AccessionMI0009889 (change log)
DescriptionBos taurus miR-708 stem-loop
Gene family MIPF0000397; mir-708
Literature search

7 open access papers mention bta-mir-708
(10 sentences)

Stem-loop
   cugugugugaagu   aa        a           a     c  g ------g    a 
5'              ggu  cugcccuc aggagcuuaca ucuag ug g       guaa c
                |||  |||||||| ||||||||||| ||||| || |       |||| g
3'              cca  gacgggag ucuucgagugu agauc ac c       cguu a
   ----------auu   gg        a           c     u  g aaguaca    c 
Get sequence
Deep sequencing
13044 reads, 93.7 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 16770523-16770631 [+]
intergenic
Database links

Mature sequence bta-miR-708

Accession MIMAT0009367
Sequence

27 - 

aaggagcuuacaaucuagcuggg

 - 49

Get sequence
Deep sequencing2459 reads, 63 experiments
Evidence by similarity; MI0004692
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).