Stem-loop sequence bta-mir-671

AccessionMI0009887 (change log)
DescriptionBos taurus miR-671 stem-loop
Gene family MIPF0000358; mir-671
Literature search

4 open access papers mention bta-mir-671
(5 sentences)

Stem-loop
   gc     -a      ----a    a        a   a      ga           -u   g 
5'   cgccg  ccuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
     |||||  ||||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
3'   guggu  ggaccg     ccgg ccuuuucc ccu cgggac  ucuuggccucc  uug a
   -c     cg      aggug    g        a   -      --           uu   u 
Get sequence
Deep sequencing
1122 reads, 7.25 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 115031675-115031792 [+]
sense
ENSBTAT00000019108 ; bta-mir-671-201; 3'UTR (exon 4)
Database links

Mature sequence bta-miR-671

Accession MIMAT0009365
Sequence

29 - 

aggaagcccuggaggggcuggag

 - 51

Get sequence
Deep sequencing237 reads, 63 experiments
Evidence by similarity; MI0003760
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).