Stem-loop sequence bta-mir-670

AccessionMI0009886 (change log)
DescriptionBos taurus miR-670 stem-loop
Gene family MIPF0000734; mir-670
Literature search

2 open access papers mention bta-mir-670
(2 sentences)

Stem-loop
   g  u      u   u      uc       --     u  -u aa    aa 
5'  gu uagggg gga cugacg  ccugagu  auaug gg  g  ccgg  u
    || |||||| ||| ||||||  |||||||  ||||| ||  |  ||||  u
3'  cg gucccu cuu gacugu  ggacuua  uauac cc  u  gguc  u
   -  c      -   -      ga       cu     u  uu gg    cg 
Get sequence
Deep sequencing
189 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 74872328-74872426 [+]
intergenic
Database links

Mature sequence bta-miR-670

Accession MIMAT0009364
Sequence

22 - 

ucccugaguauauguggugaa

 - 42

Get sequence
Evidence by similarity; MI0004295
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).