Stem-loop sequence bta-mir-665

AccessionMI0009885 (change log)
DescriptionBos taurus miR-665 stem-loop
Gene family MIPF0000404; mir-665
Literature search

1 open access papers mention bta-mir-665
(1 sentences)

Stem-loop
   -  u   -                -   cc  g  c 
5'  uc ccu ugaggggucuuggccu cug  ca ga u
    || ||| |||||||||||||||| |||  || || c
3'  gg gga acuccccggagccgga gac  gu cu u
   c  c   c                u   ca  a  u 
Get sequence
Deep sequencing
3563 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67702209-67702280 [+]
sense
ENSBTAT00000051765 ; bta-mir-665-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-665
bta-mir-493chr21: 67695365-67695453 [+]
bta-mir-665chr21: 67702209-67702280 [+]
bta-mir-431chr21: 67706530-67706643 [+]
bta-mir-433chr21: 67707406-67707529 [+]
bta-mir-127chr21: 67708504-67708598 [+]
bta-mir-432chr21: 67709994-67710083 [+]
bta-mir-136chr21: 67710178-67710269 [+]
Database links

Mature sequence bta-miR-665

Accession MIMAT0009363
Sequence

43 - 

accaguaggccgaggccccu

 - 62

Get sequence
Deep sequencing3530 reads, 63 experiments
Evidence by similarity; MI0005563
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).