Stem-loop sequence bta-mir-658

AccessionMI0009884 (change log)
DescriptionBos taurus miR-658 stem-loop
Gene family MIPF0000643; mir-658
Literature search

1 open access papers mention bta-mir-658
(1 sentences)

Stem-loop
   -----------------cccgguugccgugguugcag    ----   c   ---    uu 
5'                                      gccc    ggc cgc   cagc  g
                                        ||||    ||| |||   ||||   
3'                                      cggg    ccg gcg   gucg  u
   ggagcacggacuuccugguugccugggcgaagggagg    auua   a   aca    cc 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 110470523-110470622 [-]
sense
ENSBTAT00000014280 ; ANKRD54-201; 5'UTR (exon 1)
Clustered miRNAs
< 10kb from bta-mir-658
bta-mir-658chr5: 110470523-110470622 [-]
bta-mir-12001chr5: 110461365-110461424 [+]
Database links

Mature sequence bta-miR-658

Accession MIMAT0009362
Sequence

61 - 

ggcggagggaagcggguccguuggu

 - 85

Get sequence
Deep sequencing34 reads, 15 experiments
Evidence by similarity; MI0003682
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).