Stem-loop sequence bta-mir-656

AccessionMI0009883 (change log)
DescriptionBos taurus miR-656 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention bta-mir-656
(1 sentences)

Stem-loop
   ----------cu    u      c     ag       ---   u 
5'             gaaa agguug cugug  guguuca   cuu u
               |||| |||||| |||||  |||||||   |||  
3'             cuuu uccaac gacau  uauaagu   gaa c
   cuaagcuauagc    c      u     au       agc   u 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67883062-67883140 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-656
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-656

Accession MIMAT0009361
Sequence

44 - 

aauauuauacagucaaccucu

 - 64

Get sequence
Deep sequencing49 reads, 26 experiments
Evidence by similarity; MI0003678
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).