Stem-loop sequence bta-mir-653

AccessionMI0009880 (change log)
DescriptionBos taurus miR-653 stem-loop
Gene family MIPF0000435; mir-653
Literature search

1 open access papers mention bta-mir-653
(1 sentences)

Stem-loop
   -------       cu              u    gu     caugu 
5'        ucauucc  caguguugaaacaa cucu  ugaac     u
          |||||||  |||||||||||||| ||||  |||||     a
3'        aguaagg  guuacaacuuuguu gagg  acuug     c
   guagaau       ag              u    uc     aagga 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 10717971-10718060 [-]
sense
ENSBTAT00000023201 ; CALCR-201; intron 3
Clustered miRNAs
< 10kb from bta-mir-653
bta-mir-489chr4: 10718640-10718721 [-]
bta-mir-653chr4: 10717971-10718060 [-]
Database links

Mature sequence bta-miR-653

Accession MIMAT0009358
Sequence

12 - 

guguugaaacaaucucuguug

 - 32

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0003674

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).