Stem-loop sequence bta-mir-631

AccessionMI0009879 (change log)
DescriptionBos taurus miR-631 stem-loop
Gene family MIPF0000508; mir-631
Literature search

4 open access papers mention bta-mir-631
(10 sentences)

Stem-loop
          -cca   aga          -acc      u 
5' ggggagc    guu   ccuggcuuag    ucagcu c
   |||||||    |||   ||||||||||    |||||| a
3' ccucucg    cgg   ggacugaguc    agucga c
          aaac   --g          agau      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 33979103-33979177 [+]
antisense
ENSBTAT00000052162 ; NEIL1-201; intron 4
ENSBTAT00000046326 ; NEIL1-202; intron 5
Database links

Mature sequence bta-miR-631

Accession MIMAT0009357
Sequence

14 - 

agaccuggcuuagaccucagc

 - 34

Get sequence
Evidence by similarity; MI0003645
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).