Stem-loop sequence bta-mir-628

AccessionMI0009878 (change log)
DescriptionBos taurus miR-628 stem-loop
Gene family MIPF0000529; mir-628
Stem-loop
   auagcugu  u   a      ca  -   a   a             aaaa 
5'         ug guc cuuccu  ug cug cau uuuacuagagggu    u
           || ||| ||||||  || ||| ||| |||||||||||||     
3'         ac cgg gaaggg  gc gac gug gaaugaucuucca    u
   -------u  u   -      aa  u   g   a             auaa 
Get sequence
Deep sequencing
487 reads, 1.45 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 55187418-55187512 [+]
sense
ENSBTAT00000016938 ; CCPG1-201; intron 5
Database links

Mature sequence bta-miR-628

Accession MIMAT0009356
Sequence

23 - 

augcugacauauuuacuagagg

 - 44

Get sequence
Deep sequencing255 reads, 62 experiments
Evidence by similarity; MI0003642
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).