Stem-loop sequence bta-mir-615

AccessionMI0009877 (change log)
DescriptionBos taurus miR-615 stem-loop
Gene family MIPF0000342; mir-615
Literature search

3 open access papers mention bta-mir-615
(5 sentences)

Stem-loop
   cuc   ag   c          uc     u        cu    g ug 
5'    ggg  ggg gggagggggg  cccgg gcucggau  cgag g  c
      |||  ||| ||||||||||  ||||| ||||||||  |||| |  u
3'    ccc  ccc cccucucccu  ggguc cgagccug  gcuu u  u
   --c   ca   -          cu     -        --    g ua 
Get sequence
Deep sequencing
2028 reads, 2.99 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 26204589-26204681 [-]
sense
ENSBTAT00000012696 ; HOXC5-201; intron 1
Database links

Mature sequence bta-miR-615

Accession MIMAT0009355
Sequence

18 - 

ggggguccccggugcucggauc

 - 39

Get sequence
Deep sequencing70 reads, 31 experiments
Evidence by similarity; MI0003628
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).