Stem-loop sequence bta-mir-599

AccessionMI0009876 (change log)
DescriptionBos taurus miR-599 stem-loop
Gene family MIPF0000502; mir-599
Stem-loop
   aaagacgugcu      -a   u                 gg     -   c 
5'            guccac  gug guuugauaagcugacau  gacag gga u
              ||||||  ||| |||||||||||||||||  ||||| ||| c
3'            uaggug  uac caaacuauuugacugug  uuguc cuu u
   --------cag      ca   c                 --     a   u 
Get sequence
Deep sequencing
5 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 67323940-67324034 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-599
bta-mir-875chr14: 67323808-67323884 [+]
bta-mir-599chr14: 67323940-67324034 [+]
Database links

Mature sequence bta-miR-599

Accession MIMAT0009354
Sequence

61 - 

guugugucaguuuaucaaac

 - 80

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0003611
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).