Stem-loop sequence bta-mir-584-6

AccessionMI0009872 (change log)
DescriptionBos taurus miR-584-6 stem-loop
Gene family MIPF0000533; mir-584
Literature search

1 open access papers mention bta-mir-584-6
(1 sentences)

Stem-loop
   uuggaugaccaaucaucuugguu       ga  ga  g uu    ug 
5'                        ugccugg  cu  gg g  uccc  g
                          |||||||  ||  || |  ||||  a
3'                        acggacc  ga  uu u  aggg  u
   ---------------------gu       --  ag  g gu    ug 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 6270229-6270304 [-]
intergenic
Database links

Mature sequence bta-miR-584

Accession MIMAT0009352
Sequence

19 - 

ugguuugccugggacugag

 - 37

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).