Stem-loop sequence bta-mir-584-4

AccessionMI0009870 (change log)
DescriptionBos taurus miR-584-4 stem-loop
Gene family MIPF0000533; mir-584
Literature search

1 open access papers mention bta-mir-584-4
(1 sentences)

Stem-loop
   -----------------------------------------     uc --    -  u 
5'                                          gacca  c  uccu gg u
                                            |||||  |  |||| ||  
3'                                          uuggu  g  aggg cc u
   uggacgggucaaauucgugaccuucagggugucuggguccu     ga uc    u  g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 35820205-35820280 [+]
intergenic
Database links

Mature sequence bta-miR-584

Accession MIMAT0009352
Sequence

12 - 

ugguuugccugggacugag

 - 30

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).