Stem-loop sequence bta-mir-582

AccessionMI0009867 (change log)
DescriptionBos taurus miR-582 stem-loop
Gene family MIPF0000417; mir-582
Stem-loop
   ----------auc   u        uua            ca     uaaucu 
5'              ugu cucuuugg   caguuguucaac  guuac      a
                ||| ||||||||   ||||||||||||  |||||       
3'              acg gggaaacc   gucaacaaguug  caaug      c
   uuacaaaagugaa   u        caa            ac     uuaauc 
Get sequence
Deep sequencing
535 reads, 1.59 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 19665474-19665571 [+]
intergenic
Database links

Mature sequence bta-miR-582

Accession MIMAT0009351
Sequence

16 - 

uuacaguuguucaaccaguuacu

 - 38

Get sequence
Deep sequencing202 reads, 58 experiments
Evidence by similarity; MI0003589
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).