Stem-loop sequence bta-mir-568

AccessionMI0009866 (change log)
DescriptionBos taurus miR-568 stem-loop
Gene family MIPF0000408; mir-568
Stem-loop
   ---        -     u        a         acuucc         c 
5'    auauacac uauau auguauaa uguauacac      uauauauau c
      |||||||| ||||| |||||||| |||||||||      |||||||||  
3'    uaugugug auaug uacauauu auauaugug      auauauaua a
   gua        g     -        -         ------         u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 59568869-59568962 [-]
intergenic
Database links

Mature sequence bta-miR-568

Accession MIMAT0009350
Sequence

15 - 

auguauaaauguauacacac

 - 34

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003574
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).