Stem-loop sequence bta-mir-562

AccessionMI0009865 (change log)
DescriptionBos taurus miR-562 stem-loop
Gene family MIPF0000512; mir-562
Stem-loop
   aguggaaaugcugguucauauggcaauucuaccuuuuaugag   cu   a        u 
5'                                           gaa  gua ggcuguuu c
                                             |||  ||| ||||||||  
3'                                           uuu  cau ucgacgaa c
   ----------------------------------------ca   ac   g        a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 13858437-13858518 [-]
antisense
ENSBTAT00000006308 ; RRN3-201; intron 8
Database links

Mature sequence bta-miR-562

Accession MIMAT0009349
Sequence

63 - 

aaagcagcuguaccauuuac

 - 82

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003568
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).