Stem-loop sequence bta-mir-551b

AccessionMI0009864 (change log)
DescriptionBos taurus miR-551b stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
   agagaa      c      aa         cg     - -aga    gug 
5'       guucuc uggccu  gaaaucaag  ugggu g    ccug   c
         |||||| ||||||  |||||||||  ||||| |    ||||    
3'       uaagag gucgga  cuuugguuc  accca c    ggac   a
   -----a      u      ga         au     g ggaa    aag 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 100049884-100049978 [-]
intergenic
Database links

Mature sequence bta-miR-551b

Accession MIMAT0009348
Sequence

60 - 

ggcgacccauacuugguuucag

 - 81

Get sequence
Deep sequencing14 reads, 12 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).