Stem-loop sequence bta-mir-551a

AccessionMI0009863 (change log)
DescriptionBos taurus miR-551a stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
   ---------------------------------------------------g   a -        gacc   a 
5'                                                     ggg c caccugcu    cug a
                                                       ||| | ||||||||    ||| a
3'                                                     ucc g guggacga    gac c
   aaaggucccguugguaccuuugguucuaacccagcgggucuuugucagucug   g a        ----   c 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 50918846-50918940 [+]
sense
ENSBTAT00000027771 ; MEGF6-201; intron 3
Database links

Mature sequence bta-miR-551a

Accession MIMAT0009347
Sequence

60 - 

gcgacccaaucuugguuucca

 - 80

Get sequence
Evidence by similarity; MI0003556
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).