Stem-loop sequence bta-mir-544a

AccessionMI0009862 (change log)
DescriptionBos taurus miR-544a stem-loop
Gene family MIPF0000436; mir-544
Literature search

1 open access papers mention bta-mir-544a
(4 sentences)

Stem-loop
   auuuu      cua    u           -     u   -ga  c 
5'      caucac   ggga cuuguuaaaag gcaga ucu   uu a
        ||||||   |||| ||||||||||| ||||| |||   ||  
3'      guagug   cccu gaacgauuuuu cgucu aga   ag g
   uaauc      -aa    u           a     u   acc  g 
Get sequence
Deep sequencing
96 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67864731-67864821 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-544a
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
Database links

Mature sequence bta-miR-544a

Accession MIMAT0009346
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Deep sequencing12 reads, 11 experiments
Evidence by similarity; MI0003515
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).