Stem-loop sequence bta-mir-544b-2

AccessionMI0009861 (change log)
DescriptionBos taurus miR-544b-2 stem-loop
Gene family MIPF0000436; mir-544
Literature search

1 open access papers mention bta-mir-544b-2
(1 sentences)

Stem-loop
   ------            u       --    -   u   --     g  a 
5'       aucaccugggga cuuguua  aaug aga ucu  gguuc gu g
         |||||||||||| |||||||  |||| ||| |||  ||||| ||  
3'       uaguggacucuu gaacaau  uuac ucu aga  ccggg ua g
   ucaccg            -       cu    g   u   gu     g  a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 35704382-35704473 [-]
sense
ENSBTAT00000025584 ; THOC1-201; intron 1
Database links

Mature sequence bta-miR-544b

Accession MIMAT0009345
Sequence

56 - 

auucugcauuucuaacaaguuc

 - 77

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003515
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).