Stem-loop sequence bta-mir-544b-1

AccessionMI0009860 (change log)
DescriptionBos taurus miR-544b-1 stem-loop
Gene family MIPF0000436; mir-544
Literature search

1 open access papers mention bta-mir-544b-1
(1 sentences)

Stem-loop
   ------u       au         -         -     cu  a 
5'        caccugg  agcuuguua aaaugcaga uucca  uc g
          |||||||  ||||||||| ||||||||| |||||  ||  
3'        guggacc  uugaacaau uuuacgucu agggu  gg u
   aagcguu       -c         c         u     cc  g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 71024260-71024344 [+]
antisense
ENSBTAT00000061177 ; CHD6-201; intron 33
Database links

Mature sequence bta-miR-544b

Accession MIMAT0009345
Sequence

50 - 

auucugcauuucuaacaaguuc

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003515
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).