Stem-loop sequence bta-mir-541

AccessionMI0009858 (change log)
DescriptionBos taurus miR-541 stem-loop
Gene family MIPF0000213; mir-541
Literature search

3 open access papers mention bta-mir-541
(3 sentences)

Stem-loop
   -   -u     aaa        c    g uc    u   aaguu 
5'  acg  caggg   ggauucug uguc g  ccac cca     c
    |||  |||||   |||||||| |||| |  |||| |||      
3'  ugu  gucuc   ccuaagac acgg u  ggug ggu     a
   g   uc     cgg        -    g --    -   aaaaa 
Get sequence
Deep sequencing
1219 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67880717-67880800 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-541
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-541

Accession MIMAT0009343
Sequence

54 - 

uggugggcacagaauccggccu

 - 75

Get sequence
Deep sequencing180 reads, 54 experiments
Evidence experimental; Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).