Stem-loop sequence bta-mir-505

AccessionMI0009856 (change log)
DescriptionBos taurus miR-505 stem-loop
Gene family MIPF0000217; mir-505
Literature search

1 open access papers mention bta-mir-505
(1 sentences)

Stem-loop
   aaau      ac    u           g    a        ucua 
5'     ugaugc  ccag gggggagccag aagu uugauguu    c
       ||||||  |||| ||||||||||| |||| ||||||||    c
3'     acugcg  gguc cuccuuugguc uuca aacugcga    a
   ----      -a    u           g    c        uuug 
Get sequence
Deep sequencing
1447 reads, 5.63 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 23507268-23507357 [-]
intergenic
Database links

Mature sequence bta-miR-505

Accession MIMAT0009341
Sequence

56 - 

cgucaacacuugcugguuuccu

 - 77

Get sequence
Deep sequencing1390 reads, 71 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).