Stem-loop sequence bta-mir-504

AccessionMI0009855 (change log)
DescriptionBos taurus miR-504 stem-loop
Gene family MIPF0000437; mir-504
Literature search

4 open access papers mention bta-mir-504
(5 sentences)

Stem-loop
      -g    -            g     a    -g  u   u 
5' gcu  cugu ugggagacccug ucugc cucu  uc gua g
   |||  |||| |||||||||||| ||||| ||||  || |||  
3' cgg  gaca acccuuugggac ggacg gagg  ag cau c
      ga    u            g     c    ga  u   u 
Get sequence
Deep sequencing
2776 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 22201445-22201527 [-]
sense
ENSBTAT00000048333 ; FGF13-201; intron 3
Database links

Mature sequence bta-miR-504

Accession MIMAT0009340
Sequence

13 - 

agacccuggucugcacucuguc

 - 34

Get sequence
Deep sequencing2753 reads, 65 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).