Stem-loop sequence bta-mir-502b

AccessionMI0009854 (change log)
DescriptionBos taurus miR-502b stem-loop
Gene family MIPF0000139; mir-500
Literature search

2 open access papers mention bta-mir-502b
(3 sentences)

Stem-loop
       c - uc  -u         ucc       a  g   uuu 
5' gcuc c c  uc  aauucuugc   ccaggug ga ugc   g
   |||| | |  ||  |||||||||   ||||||| || |||   u
3' cgag g g  ag  uuaggaacg   gguccac cu acg   g
       a u ua  uc         ---       -  a   uaa 
Get sequence
Deep sequencing
13041 reads, 188 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 93946864-93946946 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-502b
bta-mir-502a-2chrX: 93942730-93942819 [+]
bta-mir-502bchrX: 93946864-93946946 [+]
bta-mir-362chrX: 93947354-93947418 [+]
bta-mir-500chrX: 93948610-93948693 [+]
bta-mir-660chrX: 93950762-93950841 [+]
bta-mir-502a-1chrX: 93952708-93952792 [+]
Database links

Mature sequence bta-miR-502b

Accession MIMAT0009339
Sequence

50 - 

aauccaccugggcaaggauuc

 - 70

Get sequence
Deep sequencing12942 reads, 77 experiments
Evidence by similarity; MI0003186
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).