Stem-loop sequence bta-mir-500

AccessionMI0009851 (change log)
DescriptionBos taurus miR-500 stem-loop
Gene family MIPF0000139; mir-500
Literature search

4 open access papers mention bta-mir-500
(16 sentences)

Stem-loop
         c     -u         uac ug    agag   uuu 
5' gcuccc cucuc  aauccuugc   c  ggug    ugc   c
   |||||| |||||  |||||||||   |  ||||    |||   u
3' cgaggg gagag  uuaggaacg   g  ccac    acg   g
         a     uc         --- gu    -gua   uaa 
Get sequence
Deep sequencing
14726 reads, 234 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 93948610-93948693 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-500
bta-mir-502a-2chrX: 93942730-93942819 [+]
bta-mir-502bchrX: 93946864-93946946 [+]
bta-mir-362chrX: 93947354-93947418 [+]
bta-mir-500chrX: 93948610-93948693 [+]
bta-mir-660chrX: 93950762-93950841 [+]
bta-mir-502a-1chrX: 93952708-93952792 [+]
Database links

Mature sequence bta-miR-500

Accession MIMAT0009337
Sequence

13 - 

uaauccuugcuaccugggugaga

 - 35

Get sequence
Deep sequencing544 reads, 65 experiments
Evidence experimental; cloned [3-4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).