|
miRBase |
|
Mature sequence bta-miR-496 |
|
| Accession | MIMAT0009336 |
| Sequence |
55 - ugaguauuacauggccaaucuc - 76 |
| Evidence | experimental; Array [3], qRT-PCR [3] |
References |
|
| 1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
| 2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
| 3 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|