Stem-loop sequence bta-mir-493

AccessionMI0009847 (change log)
DescriptionBos taurus miR-493 stem-loop
Gene family MIPF0000230; mir-493
Literature search

3 open access papers mention bta-mir-493
(4 sentences)

Stem-loop
        ccc        u                    cauuc  u 
5' cuggc   cagggccu guacaugguaggcuuucauu     gu u
   |||||   |||||||| ||||||||||||||||||||     ||  
3' gaccg   gucccgga cgugugucaucuggaagugg     ca g
        --u        c                    -cuua  c 
Get sequence
Deep sequencing
8238 reads, 23.8 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67695365-67695453 [+]
sense
ENSBTAT00000042171 ; bta-mir-493-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-493
bta-mir-493chr21: 67695365-67695453 [+]
bta-mir-665chr21: 67702209-67702280 [+]
Database links

Mature sequence bta-miR-493

Accession MIMAT0009333
Sequence

57 - 

ugaaggucuacugugugccagg

 - 78

Get sequence
Deep sequencing4543 reads, 63 experiments
Evidence by similarity; MI0003132
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).