Stem-loop sequence bta-mir-491

AccessionMI0009846 (change log)
DescriptionBos taurus miR-491 stem-loop
Gene family MIPF0000319; mir-491
Literature search

1 open access papers mention bta-mir-491
(1 sentences)

Stem-loop
    ug      cu      u      cc   c          a 
5' u  acuuag  ggguag ggggaa  cuu caugaggagu g
   |  ||||||  |||||| ||||||  ||| |||||||||| a
3' g  uggguc  uccauc ucccuu  gaa guauuccuca a
    gu      ag      u      -a   c          c 
Get sequence
Deep sequencing
172 reads, 1.75 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 23748999-23749082 [-]
sense
ENSBTAT00000061612 ; KIAA1797-201; intron 1
Database links

Mature sequence bta-miR-491

Accession MIMAT0009332
Sequence

16 - 

aguggggaacccuuccaugagg

 - 37

Get sequence
Deep sequencing111 reads, 48 experiments
Evidence by similarity; MI0003126
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).