Stem-loop sequence bta-mir-490

AccessionMI0009845 (change log)
DescriptionBos taurus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Literature search

1 open access papers mention bta-mir-490
(1 sentences)

Stem-loop
   -u    -ac      g    -   aguucauu        c      --         g   cac   u 
5'   ggag   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
     ||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
3'   cuuc   ggcgac gaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
   au    aca      -    a   ------gu        c      ca         a   -ca   a 
Get sequence
Deep sequencing
8350 reads, 38.1 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 101783304-101783430 [+]
intergenic
Database links

Mature sequence bta-miR-490

Accession MIMAT0009331
Sequence

75 - 

caaccuggaggacuccaugcug

 - 96

Get sequence
Deep sequencing8024 reads, 63 experiments
Evidence by similarity; MI0003125
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).