Stem-loop sequence bta-mir-488

AccessionMI0009844 (change log)
DescriptionBos taurus miR-488 stem-loop
Gene family MIPF0000318; mir-488
Literature search

1 open access papers mention bta-mir-488
(1 sentences)

Stem-loop
   -------------    a  a   cu  c   u      a  c        g u 
5'              gaga uc ucu  cc aga aauggc cu ucaaacag u u
                |||| || |||  || ||| |||||| || |||||||| | c
3'              cucu ag aga  gg ucu uugucg ga aguuuguu g c
   aggucuuccuuaa    c  a   cu  u   -      -  a        g a 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 59871602-59871697 [-]
sense
ENSBTAT00000061165 ; ASTN1-201; intron 4
Database links

Mature sequence bta-miR-488

Accession MIMAT0009330
Sequence

52 - 

uugaaaggcuguuucuugguc

 - 72

Get sequence
Deep sequencing99 reads, 38 experiments
Evidence by similarity; MI0004633
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).