Stem-loop sequence bta-mir-486

AccessionMI0009843 (change log)
DescriptionBos taurus miR-486 stem-loop
Gene family MIPF0000220; mir-486
Literature search

27 open access papers mention bta-mir-486
(177 sentences)

Stem-loop
   g  a    --  a  u  gu  u        g    u           c     ----   c uu 
5'  cc gcuu  gg cc gc  cc cccugacg gucc guacugagcug cccga    ggc c  c
    || ||||  || || ||  || |||||||| |||| ||||||||||| |||||    ||| |   
3'  gg cgaa  cc gg ug  gg ggggcugc cggg caugacucgac gggcu    ccg g  g
   -  a    gg  -  c  ag  u        g    c           u     cgac   u uc 
Get sequence
Deep sequencing
90179 reads, 837 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 36501847-36501970 [-]
sense
ENSBTAT00000004244 ; ANK1-201; intron 4
Database links

Mature sequence bta-miR-486

Accession MIMAT0009329
Sequence

32 - 

uccuguacugagcugccccgag

 - 53

Get sequence
Deep sequencing90151 reads, 69 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).