Stem-loop sequence bta-mir-485

AccessionMI0009842 (change log)
DescriptionBos taurus miR-485 stem-loop
Gene family MIPF0000201; mir-485
Literature search

1 open access papers mention bta-mir-485
(1 sentences)

Stem-loop
      u         cu       -    a    auuc 
5' acu gaagagagg  ggccgug auga uucg    a
   ||| |||||||||  ||||||| |||| ||||    u
3' uga uuucucucc  ucggcac uacu gagc    c
      u         uc       a    -    gaaa 
Get sequence
Deep sequencing
515 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67872328-67872400 [+]
sense
ENSBTAT00000050902 ; bta-mir-485-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-485
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
Database links

Mature sequence bta-miR-485

Accession MIMAT0009328
Sequence

9 - 

agaggcuggccgugaugaauucg

 - 31

Get sequence
Deep sequencing309 reads, 54 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).