Stem-loop sequence bta-mir-483

AccessionMI0009841 (change log)
DescriptionBos taurus miR-483 stem-loop
Gene family MIPF0000180; mir-483
Literature search

2 open access papers mention bta-mir-483
(4 sentences)

Stem-loop
   -             a  a     g c ug u  g 
5'  ggggagggcggga ga aggag g g  g cu u
    ||||||||||||| || ||||| | |  | ||  
3'  ccucuucugcccu cu uccuc c c  c ga g
   u             c  c     a u cu -  c 
Get sequence
Deep sequencing
748 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 50396051-50396118 [+]
sense
ENSBTAT00000044139 ; IGF2-202; intron 2
ENSBTAT00000017372 ; IGF2-201; intron 3
Database links

Mature sequence bta-miR-483

Accession MIMAT0009327
Sequence

43 - 

ucacuccucuccucccgucuu

 - 63

Get sequence
Deep sequencing748 reads, 55 experiments
Evidence by similarity; MI0010400
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).