Stem-loop sequence bta-mir-454

AccessionMI0009840 (change log)
DescriptionBos taurus miR-454 stem-loop
Gene family MIPF0000174; mir-454
Literature search

1 open access papers mention bta-mir-454
(1 sentences)

Stem-loop
   --------c     auua     uc            ---         ----   --u     g 
5'          uguuu    ccaga  cuagaacccuau   cgauauugu    cuc   gcugu u
            |||||    |||||  ||||||||||||   |||||||||    |||   |||||  
3'          acaag    gguuu  gguuuugggaua   guuauaacg    gag   cgaua a
   guacgggua     -aag     gu            uuc         ugau   ucu     a 
Get sequence
Deep sequencing
2162 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 10438492-10438605 [-]
sense
ENSBTAT00000028888 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-454
bta-mir-301achr19: 10448153-10448237 [-]
bta-mir-454chr19: 10438492-10438605 [-]
Database links

Mature sequence bta-miR-454

Accession MIMAT0009326
Sequence

63 - 

uagugcaauauugcuuauagggu

 - 85

Get sequence
Deep sequencing2052 reads, 65 experiments
Evidence by similarity; MI0003820
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).